Table 2 Table of the strains and plasmids used. These include the lab identifier used for each individual strain or plasmid. The strains include the reference, and the plasmids include the sgRNA target sequence
StrainLab IdentifierReference
S288CyHDO554Mortimer and Johnston 1986
K1yHEB306Sardi et al. 2018
L1374yHDPN448Sardi et al. 2018
SK1yHDPN454Sardi et al. 2018
T73yHDPN449Sardi et al. 2018
Y55yHDPN455Sardi et al. 2018
PlasmidLab IdentifiersgRNA Target Sequence
L1pHRW97ACAGTTGGTATATTAGGAGG
L2pHRW98AACAGTTGGTATATTAGGAG
H1pHRW104ACTTTGGCATACGATGGAAG
H2pHRW105ACGGAGTCCGGAACTCTAGC