Table 2 Primers for the construction of dual-luciferase reporter plasmid
GenesPrimers (5′-3′)Products (bp)
ATP8A1ATP8A1_WT _F: GCGGCTCGAGAGCACTTGTAGTTCTGATG687
ATP8A1_WT _R: AATGCGGCCGCACATAGCGACCACTTTCTG
ATP8A1_mut_F: TAGAACTGTTCGGTATAATGCACTAATATTGTTT
ATP8A1_mut_R: AGTGCATTATACCGAACAGTTCTACAATAAAGAA
CPLX1CPLX1_WT _F: GCGGCTCGAGTGAACAAGACCAAAGATAA781
CPLX1_WT- R _R: AATGCGGCCGCACAGAGAGAGAAAACAAGC
CPLX1_mut_F: TTTAGAGATTCGGTATTGAAATCAGACTGCAATA
CPLX1_mut_R: TGATTTCAATACCGAATCTCTAAAGATAGGTATG
KLF4KLF4_WT _F: GCGGCTCGAGATCACCTCGCCTTACACAT1033
KLF4_WT _R: AATGCGGCCGCTCAACCACTGACCAACATT
KLF4_mut_F: CCTTCTAATTCGGTATACAATGTTAAAAGAGGA
KLF4_mut_R: ACATTGTATACCGAATTAGAAGGAAGAAAAAAA
  • Note: WT, wild type; MUT, mutant type.