Table 1 Information of the primers used for quantitative real-time PCR validation
GenesTm(°C)Sequences (5′-3′)Products (bp)
IFIT560F: GAAGAACCCAACAACCCAGA127
R: GTTTCAGTGCACGCTTCAGA
IFI660F:AAGCCGGTTTCACTTCCTCT135
R: CTTTGGCACCCATTTCTTGT
SERPINB260F:GCAGATCAGATGGCAAAGGT131
R: AGGCACGGTGATTTGATAGG
NSG160F: TTTCAGCGAGAAGAGCACAA119
R: TGACCACAACCTTGTCAGGA
GRK560F: TGCTCCTCACCAAAGATGTG120
R: CCAGCATTCCTGCTTCTAGC
CXCL1260F: AGGGCCAACATTAAGCACCTC110
R: TTTAGCTTGGGATCAATGCACAC
FABP760F: GGGAACGTGACTAAGCCCACA172
R: TGTCTCCATCCAGGGTCACAAC
KLF460F: CTGCGGCAAGACCTACACCA123
R: AGTTCATCAGATCGGGCAAACTTC
ATP8A160F:TCTAACTGTGTGTTTGAAGGCTGGA145
R: ATCGGGTGCCATAGGGATGA
STK3560F: GGATCGACCTGATGCCTTTGA137
R: CGTTGCACGTAATGGAGATGATG
FRMD4A60F: AAGGACAACGCCACCATTGAG102
R: TGCAGCCAGTTCAAACACCAC
OASL60F:AGATGTTGAAGCCGAAGTACCC106
R: CTGAAGTCCTCCCTGCCTGT
β-actin60F: TAAGCGTGTTATCATCTC86
R: GGGACTTGTCATATTTCT