Table 3 Primers used in this study
NameDescriptionSequence (SAP1 site and Overhang)Corresponding plasmid
XF32Fmex-5 promoter (F)GCAGCTCTTCGTGGATATCAGTTTTTAAAAAATTApXF121
XF32Rmex-5 promoter (R)GCAGCTCTTCGCATTCTCTGTCTGAAACA
JF5Ftomm-20 (F)GCAGCTCTTCGATGTCGGACACAATTCTTGGpJF7
JF5Rtomm-20 (R)GCAGCTCTTCGACCCTCCAAGTCGTCGGTGTC
JF1Fgfp (F)GCAGCTCTTCGATGTCCAAGGTAACACTTAGTTTpJF5
JF1Rgfp (R)GCAGCTCTTCGACCGCCGCTTCCCTTGTAGAGCTCGTCCAT
JF2Fgfp (F)GCAGCTCTTCGGGTGGAAGCGGCTCCAAGAACACTTAGTTTpJF6
JF2Rgfp (R)GCAGCTCTTCGTTACTTGTAGAGCTCGTCCAT
XF17Fhsp-3 (1-19aa) (F)ATGAAGACCTTATTCTTGTTGGGCTTGATCGCCCTATCCGCCGTCAGTGTCTACTGC
XF17Rhsp-3 (1-19aa) (R)ACCGCAGTAGACACTGACGGCGGATAGGGCGATCAAGCCCAACAAGAATAAGGTCTT
spe-11(SAP C1) Fspe-11 promoter (F)GCAGCTCTTCGTGGGTCGACAGAACATTTTTCCGTpSDH60
spe-11(SAP C1) Rspe-11 promoter (R)GCAGCTCTTCGCATTTTATCTAGTCGGTTTGCGA
XF24Fhalotag (F)GCAGCTCTTCGATGGCCGAGGTAACACTTAGTTTTTGTpXF89
XF24Rhalotag (R)GCAGCTCTTCGACCGCCGCTTCCTCCGGAGATCTCGAGGGT
XF63Fmkate2 (F)GCAGCTCTTCGATGGTCTCCGAGCTCATTAAAGAAAACApXF222
XF63Rmkate2 (R)GCAGCTCTTCGACCACCTCCACCTCCACGGTGTCCGAGCTTGG
ePDZ (SAP C2) Fepdz (F)GCAGCTCTTCGATGCCAGAGCTCGGATTCTCGATpSDH61
ePDZ (SAP C2) Repdz (R)GCAGCTCTTCGACCAGCTCCCGTCGCGACGGGTGGATCAC
XF79Fcox-4 (F)GCAGCTCTTCGATGATGCTGCCACGTTTGpXF262
XF79Rcox-4 (R)GCAGCTCTTCGACCCTTCCACTTCTTGTTCTCGTAATC
XF76Fnpp-20 (F)GCAGCTCTTCGATGACCACGGTCCGCCAGpXF250
XF76Rnpp-20 (R)GCAGCTCTTCGACCTCTCTGAGCTCCCGGAGCT
XF23Fhalotag (F)GCAGCTCTTCGGGTGGAAGCGGCGCCGAGGTAACACTTAGTTTTTGTpXF88
XF23Rhalotag (R)GCAGCTCTTCGTTATCCGGAGATCTCGAGGGT
XF53Fmkate2 (F)GCAGCTCTTCGGGTGGAGGTGGAGGTGTCTCCGAGCTCATTAAAGAAAACpXF130
XF53Rmkate2 (R)GCAGCTCTTCGTTAACGGTGTCCGAGCTTGGA
XF22Fhalotag::hdel (F)GCAGCTCTTCGGGTGGAAGCGGCGCCGAGGTAACACTTAGTTTTTGTpXF90
XF22Rhalotag::hdel (R)GCAGCTCTTCGTTAGAGTTCGTCATGTCCGGAGATCTCGAGGGT
SIM8Fmscarlet (F)GCAGCTCTTCGATGGTCTCCAAGGGCGAGGCApSM10
SIM8Rmscarlet (R)GCAGCTCTTCGACCACCTCCACCTCCCTTGTACAGCTCGTCCATTCCT
SIM10Fdendra2 (F)GCAGCTCTTCGATGAACCTTATTAAGGAAGATATGpSM12
SIM10Rdendra2 (R)GCAGCTCTTCGACCGCCGCTTCCCCATACTTGACTTGGTAG
SIM1Fdendra2 (F)GCAGCTCTTCGGGTGGAAGCGGCAACCTTATTAAGGAAGATATGpSM03
SIM1Rdendra2 (R)GCAGCTCTTCGTTACCATACTTGACTTGGTAG
SIM2Fmkate2 (F)GCAGCTCTTCGGGTGGAGGTGGAGGTGTCTCCGAGCTCATTAAAGAAAACApSM04
SIM2Rmkate2 (R)GCAGCTCTTCGCGTACCTCCACCTCCACGGTGTCCGAGCTTGGA
SIM3Fmkate2 (F)GCAGCTCTTCGACGGGAGGTGGAGGTGTCTCCGAGCTCATTAAAGAAAACApSM05
SIM3Rmkate2 (R)GCAGCTCTTCGTTAACGGTGTCCGAGCTTGGA
SIM6Fmscarlet (F)GCAGCTCTTCGGGTGGAGGTGGAGGTGTCTCCAAGGGCGAGGCApSM08
SIM6Rmscarlet (R)GCAGCTCTTCGTTACTTGTACAGCTCGTCCATTCCT
mScarlet (SAPC3)Fmscarlet (F)GCAGCTCTTCGGGTGTCTCCAAGGGCGAGGCAGTCATpSDH57
mScarlet (SAPC3)Rmscarlet (R)GCAGCTCTTCGCGTGGCCGCGGCTTTTGCAGCGG
XF84Flov (F)GCAGCTCTTCGACGCCTCGTCTTGCTGCTpXF276
XF84Rlov (R)GCAGCTCTTCGTTAGACCCAAGTGTCGACGGC
XF12Fpie-1 3′UTR (F)GCAGCTCTTCGTAATTTTGCCGTATTTTCCATpXF85
XF12Rpie-1 3′UTR (R)GCAGCTCTTCGTACATCATCGTTCACTTTTCAC
tbb2 3′UTR (SAPC5)Ftbb-2 3′UTR (F)GCAGCTCTTCGTAAATGCAAGATCCTTTCAAGCATTCpSDH54
tbb2 3′UTR (SAPC5)Rtbb-2 3′UTR (R)GCAGCTCTTCGTACGACTTTTTTCTTGGCGGCAC
Halo (SAP C3)Fhalotag (F)GCAGCTCTTCGGGTGGAAGCpSDH51
Halo (SAP C3)Rhalotag (R)GCAGCTCTTCGCGTTCCGGAGATCTCGAGGGTGG
ePDZ (SAP C4)Fepdz (F)GCAGCTCTTCGACGGGAGGTTCCGGAGGATCTGGCpSDH52
ePDZ (SAP C4)Repdz (R)GCAGCTCTTCGTTACGTCGCGACGGGTGGAT
unc-54 (SAPC5)Func-54 3′UTR (F)GCAGCTGTTCGTAAGAGCTCCGCATCGGCCGCTGpSDH66
unc-54 (SAPC5)Runc-54 3′UTR (R)GCAGCTCTTCGTACAAACAGTTATGTTTGGTATATTGGGA
Eg717Replace pCFJ350 MCS (F)TCGAGTGGCGAAGAGCCCATGGATCCCATATGGAATTCTGCAGGCCTGCTCTTCGGTAApXF87
Eg718Replace pCFJ350 MCS (R)CTAGTTACCGAAGAGCAGGCCTGCAGAATTCCATATGGGATCCATGGGCTCTTCGCCAC
XF30FMutate SapI site in pCFJ350GATTATGGGCACTTCTTTTATCCpXF87
XF30RMutate SapI site in pCFJ350CGACAAGCAACTTTTCTATAC
XF31FMutate SapI site in pCFJ350AATGGCGAAGtGCAAAGCAGAGpXF87
XF31RMutate SapI site in pCFJ350GTTTCCTGAAAATAATGTAACTTGAATTG
  • Note: For the expression plasmid pJF13 annealed oligos were used to generate HSP-3(aa 1-19) in cassette 2.

  • Additional oligo sequences used to generate pSDH50:

  • TOMM-20 short forward. GCAGCTCTTCGATGTCGGACACAATTCTTGGTTTCAAcaaatcaaacgtcgttttggctgctggaattgctggagccgctttcctcggctactgcatttacttcgatcataagagaatcaacgctccagactacaaggacaagattaggcaaagtcagtgttttaacaacatatttccttcggatttttatctaaaaacaacttattttctttcagagagaCGTGCCCAGGCTGGAGCAggagctggtgcaggcgctggagccggagccGGTCGAAGAGCtgc.

  • TOMM-20 short reverse GCAGCTCTTCGACCggctccggctccagcgcctgcaccagctccTGCTCCAGCCTGGGCACGtctctctgaaagaaaataagttgtttttagataaaaatccgaaggaaatatgttgttaaaacactgactttgcctaatcttgtccttgtagtctggagcgttgattctcttatgatcgaagtaaatgcagtagccgaggaaagcggctccagcaattccagcagccaaaacgacgtttgatttgTTGAAACCAAGAATTGTGTCCGACATCGAAGAGCtgc.