Table 2 List of primers used and their annealing temperature
PrimerSequenceAnnealing temp. (°C)1
Ca_Sb07g023730_F15′-TACGCCTTCTACTTCCTCGTC-3′
Ca_Sb07g023730_R55′-AGCAGCAGAAGACGGTGAAGTAG-3′
RB2_F115′-ACTTGCCCCACTACAAGCAC-3′61
D2UPF15′-CATGTTCCTTAATTCCTTTTTGC-3′
D2UPR15′-ACTTGAGGAGGCACAAACTCATAC-3′
D2UPRBF125′-GAAGCCTTTGCTATCGTAGTGTG-3′55
Ca_Sb07g023730_F1035′-GCAGGTTCTCCTTGATGCTC-3′
Ca_Sb07g023730_R1035′-CTCGGAGGCACCTACTTCAC-3′59
Ca_ABCB1_F205′-CATGACCTCAAGAGCCTGAA-3′60
Ca_ABCB1_R205′-GAGCTTGATGATGAAGGAGTG-3′
Ca_GAPDH_F15′-CTGTCGGTAAGGTTCTTCCTGAAT-3′60
Ca_GAPDH_R15′-CTAACAGTGAGGTCAACAACTGACAC-3′
Ca_Act_F15′-AGATCATGTTTGAGACCTTTGAATG-3′60
Ca_Act_R15′-ATCACCAGAGTCCAGCACAATAC-3′
D2T_F75′-CCGTTGAAGCTTCAGACGCCATTCCAAATCCCCATCTT-3′72
D2T_R75′-CTGGTAAGGATCCGCTGCTGGTTGCTTCTTT-3′
D2T_R1645′-GCGTTCCTTCCCAATGAGCTCTGC-3′
D2T_F955′-CCAAGATCTTCCGCATCATCGACCAC-3′
D2T_Tail_R15′-CTGGTAAGGATCCCTAAGCATCATCTTCCTTAACCCTAGAACTT GAACCTGACGTCATACCAATCACTTGTGTATGCGTAAATCTTTG CAACTGCAGCATGCGCGCGTAG-3′
D2T_F155′-CGTACTTGGGCATTTAACGCCCTGAC-3′72
D2T_R105′-CGTAGAACCTCTCGATGAGCGACACGA-3′
AtABCB1_F15′-CACCAACAACAACTCACGAAGC-3′
AtABCB1_R15′-TAGACCCACAACATTCGAGACCCATC-3′60
At_ActF15′-ATGAAGATTAAGGTCGTGGCA-3′
At_ActR15′-GTGCACAAATGACAAAGGGGAA-3′51
Br2F205′-CATGACCTCAAGAGCCTGAA-3′
Br2R205′-GAGCTTGATGATGAAGGAGTG-3′52
716F5′-GAAGAGCCTAAGAAAGCAGA-3′
716R5′-GGTCAAATGGTGGCGAACTA-3′
LB265′-GCTTCCTATTATATCTTCCCAAATTACCAATACA-3′53
MDR1F5′-CATTTTATAATAACGCTGCGGACATAC-3′
MDR1R5′-CTTGAATCACACCAATGCAATCAAACACCTC-3′
LB1a75′-TGGTTCACGTAGTGGGCCATCG-3′60
  • 1 Primer used in combination with Ca_Sb07g023730 R5.

  • 2 Primer used in combination with D2UPR1.

  • 3 From Parvathaneni et al. 2013.

  • 4 Primer used in combination with D2T_F7.

  • 5 Primer used in combination with D2T_R7.

  • 6 Primer used in combination with 716R.

  • 7 Primer used in combination with MDR1F.