Table 3 Amplicon repair template primers. Forward and reverse primer sequences used to make amplicons noted in each figure legend. Note some primers were used to generate more than one amplicon
NamePrimer SetsTemplateProduct
Figure 2 Amplicon 1F: cataaaactttgaccttgtgaagtgtcaaccttgaagtgattatagtctctgttttcgpCFJ70Pmyo-3
(2.1)R:ctcaccattaagcctgcttttttgtacaaacttgtcaattctagatggatctagtggtcg
Figure 2 Amplicon 2F: acaagtttgtacaaaaaagcaggcttaatggtgagcaagggcgaggagctgT5V - pTurquoise_5aa_VenusVenus
(2.2)R: gtacaagaaagctgggtactagatccggtggatcccgg
Figure 2 Amplicon 3F: ccgggatccaccggatctagtacccagctttcttgtacpCFJ90unc-54 UTR
(2.3)R:gctcaattcgcgccaaactatggtggttcgacagaaacagttatgtttggtatattg
Figure 2 Amplicon 4F:tcagtgcagtcaacatgtcgagtttcgtgccgaatagtgattatagtctctgttttcgttaattttgpCFJ70Pmyo-3
(2.4)R:ctcaccattaagcctgcttttttgtacaaacttgtcaattctagatggatctagtggtcg
Figure 2 Amplicon 5F: ccgggatccaccggatctagtacccagctttcttgtacpCFJ90unc-54 UTR
(2.5)R: aaacagaaaattaatactgtccgcgtttgctctttaacagttatgtttggtatattg
Figure 2 Amplicon 6F:aaagacgatgagttctactggcgtggaatccacaaagtgattatagtctctgttttcgpCFJ70Pmyo-3
(2.6)R:ctcaccattaagcctgcttttttgtacaaacttgtcaattctagatggatctagtggtcg
Figure 2 Amplicon 7F: ccgggatccaccggatctagtacccagctttcttgtacpCFJ90unc-54 UTR
(2.7)R: cgctagctacacatttttcccatctctcgggcaataacagttatgtttggtatattg
Figure 3 Amplicon 1F:tcagtgcagtcaacatgtcgagtttcgtgccgaatcattttatatctgagtagtatcctttgcpCFJ90Pmyo-2
(3.1)R: ttactcattaagcctgcttttttgtacaaacttgt
Figure 3 Amplicon 2F:acaagtttgtacaaaaaagcaggcttaatgagtaaaggagaagaacpCZGY1614GFP
(3.2)R:aaacagaaaattaatactgtccgcgtttgctctttttatttgtatagttcatccatg
Figure 3 Amplicon 3F:acaagtttgtacaaaaaagcaggcttaatgagtaaaggagaagaacpCZGY1614GFP
(3.3)R:tacaagaaagctgggtattatttgtatagttcatccatg
Figure 3 Amplicon 4F: GatgaactatacaaataatacccagctttcttgtacpCFJ90unc-54 UTR
(3.4)R: aaacagaaaattaatactgtccgcgtttgctctttaacagttatgtttggtatattg
Figure 3 Amplicon 5F:acaagtttgtacaaaaaagcaggcttaatgagtaaaggagaagaacpCZGY1614GFP
(3.5)R:gagaccatcgatgctcctgaggctcccgatgctcctttgtatagttcatccatgcc
Figure 3 Amplicon 6F:ggagcatcgggagcctcaggagcatcgatggtctcaaagggtgaagaagpCFJ90Cherry
(3.6)R:ccgatgcggagctcagatatcacccactttgtaca
Figure 3 Amplicon 7F: tgtacaaagtgggtgatatctgagctccgcatcggpCFJ90unc-54 UTR
(3.7)R: aaacagaaaattaatactgtccgcgtttgctctttaacagttatgtttggtatattg
Figure 4 Amplicon 1F:tcagtgcagtcaacatgtcgagtttcgtgccgaatgacgacgacgacctcgacggcaacpSEP45Prab-3
(4.1)R:gccatttttaagcctgcttttttgtacaaacttgtctgaaaatagggctactgtag
Figure 4 Amplicon 2F:acaagtttgtacaaaaaagcaggcttaaaaatggctgcgttcttgctgagacpBB34Sdhc::MAC
(4.2)R:ggatcctcctcctccagatcctcctccacctcgggcgccgtcgtcctcgccgatc
Figure 4 Amplicon 3F:cccgaggtggaggaggatctggaggaggaggatccatggtttccgagttgatcaaggpKT133mKate
(4.3)R:ttaacgatgtccgagcttggatgggagatcacaatatc
Figure 4 Amplicon 4F:attgtgatctcccatccaagctcggacatcgttaagtccaattactcttcaacpCFJ90unc-54 UTR
(4.4)R: aaacagaaaattaatactgtccgcgtttgctctttaaggtattttgtgtgcgg
Figure 4 Amplicon 5F:tcagtgcagtcaacatgtcgagtttcgtgccgaatagcacagaactgcattaagpELA10Pvha-6
(4.5)R:gccatttttaagcctgcttttttgtacaaacttgtatttttatgggttttggtag
Figure 4 Amplicon 6F: tcagtgcagtcaacatgtcgagtttcgtgccgaatagtgattatagtctctgttttcpAYW7Pmyo-3
(4.6)R: gccatttttaagcctgcttttttgtacaaacttgtcaattctagatggatctagtg