Table 2 crRNA for CRISPR-Homology Directed Repair editing. crRNAs were selected using the guide design tool, crispr.mit.edu
Gene TargetcrRNA target sequence
crRNA1CTATGGTGGTTCGACAGTCA
crRNA2GTCCGCGTTTGCTCTTTATT
crRNA3CCCATCTCTCGGGCAATTTG