Table 1 Sequences used for CRISPR/Cas9, MosSCI, cloning and diagnosis. Table of the DNA/RNA sequences used for construction of the strains in this manuscript
Sequence nameSequence
ollas::rpa-1 ssODNTtccccaatttttatgtatctgtttcagatagtgaaagatgtccggattcgccaacgagctcggaccacgtctcatgggaaaggcggcaattcacatcaatcacgatgtcttcaataa
gfp11::rpa-1 ssODNttccccaatttttatgtatctgtttcagatagtgaaagatgCGTGACCACATGGTCCTCCACGAGTACGTCAACGCCGCCGGAATCACCGGTGGCGGCAAATTCgcggcaattcacatcaatcacgatgtcttcaataa
gfp11::akir-1 ssODNttacttctcgtaaccacaaattatttctttcagaagtaaaatgCGTGACCACATGGTCCTCCACGAGTACGTCAACGCCGCCGGAATCACCGGTGGCGGCAAATTCGCTTGCGGACTCGCACTGAAAAGACCTCTCCAACATGAGTACGAGTCTTTTTTAACTGATGAGACATACAACGGAGAAGCAAAGCGAGCC
gfp11::syp-4 ssODNgttcggtacggtaacctcatttttcatcaaaattttttatttcaaggcgaaataatgCGTGACCACATGGTCCTCCACGAGTACGTCAACGCCGCCGGAATCACCGGTGGCGGCAAATTCtcgtttccgacgTtacaagtGAgAccaaatgagaaaaatccaaaagttctgcgatgcc
3xgfp11 ssODNATGCGTGACCACATGGTCCTCCACGAGTACGTCAACGCAGCCGGAATCACCGGTGGCGGCAAATTCCGTGACCACATGGTCCTCCACGAGTACGTAAACGCAGCCGGAATCACCGGTGGCGGCAAATTCCGTGACCACATGGTCCTCCACGAGTACGTAAACGCCGCCGGAATCACCGGTGGCGGCAAATTC
rpa-1 crRNAUUUCAGAUAGUGAAAGAUGG
akir-1 crRNAGAUUCAUACUCGUGUUGCAG
syp-4 crRNAUUUGGACGUACUUGUAGCGU
gfp11 crRNACACGAGUACGUCAACGCCGC
gfp1-10 g-block with intronsATGAGTAAAGGAGAAGAATTGTTCACTGGAGTTGTCCCAATCCTCGTCGAGCTCGACGGAGACGTCAACGGACACAAGTTCTCCGTCAGAGGAGAGGGAGAGGGAGACGCCACCATCGGAAAGCTCACCCTCAAGTTCATCTGCACCACCGGAAAGCTCCCAGTCCCATGGCCAACCCTCGTCACCACCTTGACATACGGAGTCCAATGCTTCTCCCGTTACCCAGACCACATGAAGCGTCACGACTTCTTCAAGTCCGCCATGCCAGAGGGATACGTCCAAGAGCGTACCATCTCATTCAAGGTAAGTTTAAACATATATATACTAACTACTGATTATTTAAATTTTCAGGACGACGGAAAATACAAGACCCGTGCCGTGGTCAAGTTCGAGGGAGACACCCTCGTCAACCGTATCGAGCTCAAGGTAAGTTTAAACAGTTCGGTACTAACTAACCATACATATTTAAATTTTCAGGGAACTGACTTCAAGGAGGACGGAAACATCCTCGGACACAAGCTCGAGTACAACTACAACTCCCACAACGTCTACATCACAGCCGACAAGCAAAAGAACGGAATCAAGGCCAACTTCACTATCCGTCACAACATCGAGGACGGATCCGTCCAACTCGCCGACCACTACCAACAAAACACCCCAATCGGAGACGGACCAGTCCTCCTCCCAGACAACCACTACCTCTCCACCCAAACCGTCCTCTCCAAGGACCCAAACGAGAAG
gfp1-10 FCAAGAGCGTACCATCTCATTCAAG
gfp1-10 RGTTGTGGGAGTTGTAGTTGTACTC