Table 1 – Strains, Plasmids and Primers
Strain NumberGenotype
Saccharomyces cerevisiae
YJF153WT
DMy49snz1::kanMX-loxP
DMy51snz1::kanMX-loxP snz3::hphMX-loxP
DMy52snz1::kanMX-loxP snz2::natMX-loxP snz3::hphMX-loxP
DMy53snz2::kanMX-loxP
DMy54snz2::kanMX-loxP snz3::natMX-loxP
DMy55sno1::kanMX-loxP
DMy56snz1::kanMX-loxP snz2::hphMX-loxP
DMy57snz3::kanMX-loxP
Salmonella enterica
DM7080ΔaraCBAD
DM15839ΔaraCBAD pdxJ662::Kn / pSU18
DM15840ΔaraCBAD pdxJ662::Kn / pDM1595
DM15843ΔaraCBAD pdxJ662::Kn / pDM1595 pBAD24
DM15844ΔaraCBAD pdxJ662::Kn / pDM1595 pDM1596
Plasmid NameDescription or Reference
pSU18(Bartolomé et al. 1991)
pBAD24(Guzman et al. 1995)
pDM1595pSU18-SNZ3
pDM1596pBAD24-SNO3
Primer NameSequence
CMCCTCGACATCATCTGCCC
AGP3RCGTTCCAGAATAGAAGGTCGA
RPD3RTGTCAACTATGCGGGTGGTTT
pdxJ FAACGCACAGTAAAAACGAAGAAAGATTAACGAGGATTGTCGTGTAGGCTGGAGCTGCTTC
pdxJ RGGGCAATCTCTACAATATCCGTTCCCAGGCCGAGAATCGCCATATGAATATCCTCCTTAG
5′ SNZ2 SacITAGGGAGCTCAGGAGGACAGCTATGTCAGAATTCAAGGTTAAAACTG
3′ SNZ2 XbaITAGGTCTAGACTACCATCCGATTTCAGAAAGTC
SNZ1 FAGTAAATATACACAGTACTAATATTCAGTTAATTATCACGCAGCTGAAGCTTCGTACGC
SNZ1 RGGAAAAGTGTTATAATGCTCAAAATACCTGTTCAAAGAAAGCATAGGCCACTAGTGGATCTG
SNZ2 FACTATAATAGAAAAATAAGTATATCGTAAAAAAGACAAAACAGCTGAAGCTTCGTACGC
SNZ2 RTCGAAGGAAACAAATTAGCGTTGTGTGAGCATCGCTAGTTGCATAGGCCACTAGTGGATCTG
SNO1 FTTCATTTCGTTAAATAGAAAGAAAAACCATATCTTAAAGTCAGCTGAAGCTTCGTACGC
SNO1 RAGGTTTTGGTAATATAAAAATGTGGAAAACCGGCGGTATTGCATAGGCCACTAGTGGATCTG
5′ SNO2 NcoI 2TAGGACCATGGCCGTCGTTATCGGAGT
3′ SNO2 PstI 2TAGGCTGCAGAGGCGAGTTCAGAATGAACA
5′ SNZ2 NheITAGGGCTAGCATGTCAGAATTCAAGGTTAAAACTG
3′ SNZ2 NcoITAGGCCATGGCTACCATCCGATTTCAGAAAGTC
ALG9 qRT-PCR FTCACGGATAGTGGCTTTGGT
ALG9 qRT-PCR RCATTCACTACCGGTGCCTTC
UBC6 qRT-PCR FATCCTGGCTGGTCTGTCTCA
UBC6 qRT-PCR RATTGATCCTGTCGTGGCTTC
SNZ2/3 qRT-PCR FGCAATGATCCGTACCAAAGG
SNZ2/3 qRT-PCR RCCGCCTTAATCTTGGTGATG
  • Underlining identifies an added ribosome binding site (RBS), bold letters represent start codon.