Table 1 Primer sequences of the markers used in this study
MarkersForward primer (5′-3′)Reverse primer (5′-3′)PCR (bp)Tm (°C)
Traes_2AS_3381A39C6GTTCCACACCCAAGATGGTTACTGAAAGAAACACTAAGCTGAGGAG50355
SNP19777336TGAATATATAGCAGTATGGGTGGCAGGTACCAAACGCCATGAAAGGG107555
IWB58709GGTTGAGTTTCCGAGTTTCGTGGTTCTTGTTCTCCCGTTTGTGC150558
GWM636-MTGCGGTAGTTTTTAGCAAAGCGTTTGTCTGGATAATACGACCCCC73856
IWB64569AGCCCTTGCGGAATTCATGGCAAAGCTACAGCAGTATGTACACAAAAGCCTG135155
Traes_2AS_5CAF7A367TCCATCCACAACACCTACCCGCAGCGTAATAATACTTCCTATGAT172555
IWB72490CTCCACCGCTCATCTTCCTGTCCCCCAACCGACATTATCC155955
WMC407-MGCATCTTGTGTTGGTGTTGCCTCAAGGGTGCGTTTTTCACTTC42353
Traes_2AS_D11AD107BGTTCGCATCTCCGCCTTTAGGTGGTCACAGGGTAGAAGTATTTCGG161755
Traes_2AS_27D2CB02ACAAGACACACAGACCTGCTTTTTCACTGTAATAAAGTGGTAAAGTGAAGC167553
IWB11136GTCTACATGAAAATAAGCTGCTGAGGGATGGAGTTTTGGGTTTAAGTTCTAG36552
SNP30671452TGGAGGAAGACGATGGAGACTGGCAAACCACCAAAGAAGAACCG58161
IWB47995GCTCCCCAAGGACAACATCAAGAGAGCCAAGAGCAAGCATACC49760