Table 1 Primers for identifying the MRI95845 mutation
AmpliconForwardReverse
Snai2CATCTGCAGACCCACTCTGATGGTTGGTAAGCACATGAGAA
Tbc1d23CACCCCCTTTTTGGTTTCTTACGTGCACATCGACTAACCA
Pnpla6AGGCTGAGGAAGTGTGCCTAAACTAGCTGGGCTTTGGTCA
Zglp1CTGGCCTTTGACTTCTGACCCCTCACAAGGTGGCTGTTTC
Ank-1CTCCAAGTGAGAGGGTTTGCGATGGCACACAGTCAGACCA