Table 2 Primers for identifying the MRI96570 mutation
AmpliconForwardReverse
Fat4CGCATCCCTTCATACAACCTACACCCCACTCACGTAGCTC
RhcgTGAGGAATGAGGGAGAAAGGCCAATATGGCAGCCCTCTAA
Plxnb3TACCCGATCAATCCAGAAGGTTCTGAATGTGCAGGGTCAC
Ank-1TGTGCAGGCATTTCTACATGAACTCTCTGGGTAGACCCCGT