Table 2 Primers used in this study
Name5′ → 3′ SequenceRemark
SCL639CACCTTAGCACGACGAATCAPrimer for carRP disruption, 5′ region
SCL640ACTGGCCGTCGTTTTACCGGTGTGGAGAAAGAGGTGTPrimer for carRP disruption, 5′ region
SCL641GTCATAGCTGTTTCCTGCACTATCCCAGCAGAGCACAPrimer for carRP disruption, 3′ region
SCL642GCCATTTGTGTCTTGGGTTTPrimer for carRP disruption, 3′ region
SCL643ATGCGCATCTTCTTGGTCTTNested forward primer for carRP disruption
SCL644GCTTCTTTCTGGGCATGTGTNested reverse primer for carRP disruption
SCL649GGGAGGCAACAGATTGTGAT5′ outside forward of carRP disruption confirmation
SCL650TCTTTTTGCTGTTGCTGTGC3′ outside reverse of carRP disruption confirmation
SCL566ACCCACTCACTTTCCATTCGPrimer for pyrG to determine insertion
SCL567TGCTTTTGTTGGCTGAGATGPrimer for pyrG to determine insertion
SCL635TCTAGA GGGAGTCAAGGCAGGTCTTTpyrG blaster 237-bp fragment with XbaI overhang
SCL636GCGGCCGCTGATAACTGATGCGCTGCATpyrG blaster 237-bp fragment with NotI overhang
SCL286CGGCAAGTACTGTGTCCTCAForward primer for cnbR disruption
SCL287ATGGCAAAGTCGAAGAGGAAReverse primer for cnbR disruption
SL1TCCACCACAGTGACCTTGAAForward primer for Southern blotting probe for carRP
SL2GGGGAGTGATAGGGCAGAATReverse primer for Southern blotting probe for carRP
JOHE22226TAAGGTCGATGTTGCCACTGForward primer for 5′ outside of cnbR disruption confirmation
JOHE22231CGAAAACAACAAACGCATTGReverse primer for 3′ outside of cnbR disruption confirmation