Table 1 Primers of genes used in RT-qPCR
Gene IDPrimer SequenceAccession NumberProduct Length (bp)
ACTR6F: CACGTCAGCGTCATTCCCAANM_204637.199
R: GCCGGAGGGGTCTTTGATTT
CHD6F: ACACACAGGGCAATCCTCTCXM_015296251.1146
R: CCTGTTCTTCAAGCGATGCG
LLGL1F: CTCCAGCAAGGAGGCCAACXM_015294418.1146
R: AGGTGTCGGCGAAGTAAAGG
NEURL1BF: ACAGCAGCTTCCAAGACACAXM_015293830.171
R: GTTGGGCAGGCTGTAGTAGG
XLOC_045161F: TCAGAGGCCAATACTCCGAAATCONS_00063548a102
R: AACACCCTGGAAAGAGCGTG
XLOC_070302F: ATGTGGGTGAGTTGTGTCGGTCONS_0009739887
R: TGTGATCCAAGGCATCGCTC
XLOC_068731F: GGCTTATCCCTCAAGCCCCTCONS_00095558101
R: ATGGCCGGAAATGATTCGCA
XLOC_022661F: CATGCTCTGGTGCTGGAATCTCONS_00031800107
R: CTGCTATCCGGAAGCGTGAA