Table 1 Primers for parentage analysis
Primer NameaPrimer Sequence (5′–3′)Code
1-FCCCCAGAGCAGGTTCAATCJN902297
1-RGCGCTAACAGGTGTTCAAACA
2-FCGTCAGTGGTTACAGGCAACJN902320
2-RCAATGACACCCTTGTCGTTCG
3-FACACCGTCATAGTGTTTGGCAJN902351
3-RACAGCTTGGCAGTGTTCTCT
4-FGACTCTTCATCGACTGGGAGACJN902892
4-RGCTGGGCGATAGAGAGACAT
5-FTCAAGGACTGTGTTACGAAGGAGJN902384
5-RGAACCCAGATGAGCTGGATGA
8-FAGTCTGGCCTGGAGTTTGTJN902469
8-RAGCTACCAGGTGAGGAGC
10-FTGTTGTTTCCTGTCTCCGTCTGJN902541
10-RGTCACAGCTGCAGTCACAC
11-FCTGTGGCGCTATGCTCAATTACJN902870
11-RCGGTGTCTGTGGATCTGTTCT
12-FAGGAGAACAGGTCAGTCATACGAJN902640
12-RCTCGTTCCAAACTCTCCTCCA
15-FTTTATCTCAGCCAGCAGCAAHM060584
15-RCCACGGACAACGCACTTTA
16-FGGACCTGCTGCTGTTATGTCEU907031
16-RCTGCACAGGAGTGAACTGTG
17-FAGCTGGAGCTACCACTACCTJN902723
17-RCGGACCATGCACGTATTGAAC
18-FGGCTGTTAATCTGGTCACAJN902750
18-RCAGATAATTGGTCCCCTGAA
20-FTGCTGCAGTGAGGGTTTCACJN902776
20-RCCAGAAAACACTGGCAGCTCT
21-FAGCCAGAGTCTCACACATCGJN902795
21-RGCGTGCTACAAAGAACAGACG
  • a The Tm for all pair of primers is 56°.