Table 4 Variants observed between Ward and Horn et al. (2011) beaver mitochondrial assemblies
Variant StartVariant EndLengthAmino Acid ChangeCDS PositionChangeCodon ChangePolymorphism Type
1,6801,6801C→TSNP (transition)
2,2092,2080-TTCDeletion
2,6302,6301A→TSNP (transversion)
2,7862,786130C→TACC→ACTSNP (transition)
3,2003,2001444C→TATC→ATTSNP (transition)
3,2963,2961540G→ACCG→CCASNP (transition)
3,3233,3231567A→GACA→ACGSNP (transition)
3,6683,6681912T→CTAT→TACSNP (transition)
3,6883,6881T→M932C→TACA→ATASNP (transition)
4,6054,6051684T→CCTT→CTCSNP (transition)
4,6744,6741753C→TCTC→CTTSNP (transition)
4,7704,7701849C→TGCC→GCTSNP (transition)
5,1785,1781T→CSNP (transition)
5,4095,409166T→CTTT→TTCSNP (transition)
5,5415,5411198T→CATT→ATCSNP (transition)
5,6525,6521309A→GTGA→TGGSNP (transition)
6,3126,3121969G→ATGG→TGASNP (transition)
6,3606,36011017C→TCTC→CTTSNP (transition)
6,5226,52211179T→CTTT→TTCSNP (transition)
7,0437,043113C→TCTA→TTASNP (transition)
7,4537,4531423A→GCGA→CGGSNP (transition)
7,4897,4891459A→GCTA→CTGSNP (transition)
7,8347,834151T→CATT→ATCSNP (transition)
7,9097,9091126T→CGTT→GTCSNP (transition)
8,0138,013169T→CATT→ATCSNP (transition)
8,2848,2841I→V340A→GATT→GTTSNP (transition)
8,6518,651127T→CCAT→CACSNP (transition)
8,7028,702178C→TCTC→CTTSNP (transition)
8,9428,9421318G→ACTG→CTASNP (transition)
9,3569,3561732C→TTTC→TTTSNP (transition)
10,01310,0131120T→CATT→ATCSNP (transition)
10,01910,0191126T→CATT→ATCSNP (transition)
10,03610,0361V→A143T→CGTC→GCCSNP (transition)
10,08210,0821189T→CATT→ATCSNP (transition)
10,11210,1121219A→GGTA→GTGSNP (transition)
10,51910,5191336C→TGCC→GCTSNP (transition)
10,59110,5911408A→GTGA→TGGSNP (transition)
10,69010,6901N→K507C→AAAC→AAASNP (transversion)
11,52811,52811345T→CTTA→CTASNP (transition)
11,73411,7341(A)5→(A)6Insertion (tandem repeat)
12,51712,5171759A→GGTA→GTGSNP (transition)
13,36613,36611608G→ATCG→TCASNP (transition)
13,94513,9451G→ASNP (transition)
14,00514,0051A→GSNP (transition)
14,46614,4661I→V304A→GATC→GTCSNP (transition)
14,63714,6371D→N475G→AGAC→AACSNP (transition)
14,70314,7031F→L541T→CTTC→CTCSNP (transition)
14,83714,8371675C→TACC→ACTSNP (transition)
14,95414,9541792T→CACT→ACCSNP (transition)
15,35615,3561(A)5→(A)6Insertion (tandem repeat)
15,51515,5151T→CSNP (transition)
15,54415,5441T→CSNP (transition)
15,63215,6321T→ASNP (transversion)
15,63415,6341G→ASNP (transition)
15,67415,6741T→CSNP (transition)
15,68515,6851G→ASNP (transition)
15,69215,6921C→TSNP (transition)
15,75515,7551C→TSNP (transition)
15,76615,7661C→TSNP (transition)
15,81315,8131G→ASNP (transition)
15,81515,8151A→GSNP (transition)
15,817> 15817> 1GT→ADeletion
15,90715,9071+AInsertion
16,37616,43964(ACACGTATACACGTATACACGTATACACGTAT)8→(ACACGTATACACGTATACACGTATACACGTAT)10Insertion (tandem repeat)
16,50416,5041A→CSNP (transversion)
16,50716,5093+ACCInsertion
16,52716,5282GC→CGSubstitution
16,68916,6891A→GSNP (transition)
  • CDS, coding sequence; SNP, single nucleotide polymorphism.