Table 3 Satellite composition of each chromosome in the D. melanogaster species complex
D. melanogasterD. simulansD. mauritianaD. sechellia
XAATAT
359/372/260359/372/260359/372
IGSIGSIGSIGS
AAGAGAAGAGAAGAG
AATAGAATAG
GAACAGAACATGTTC
TAGATAGATAGATAGA
YAATATAATATAATATAATAT
AAGAC
AATACAATAC
AATAGAATAGAATAG
AATAGAC
AATAAACAATAAAC
IGSIGSIGS
AAGAGAAGAGAAGAG
AACAC
AAAACAAAAC
AAGAGAGAAGAGAG
AACAAAC
GAACAGAACATGTTCa
IIAATAG
AAGAG
Prod
AACACAACAC
AAGAC
AACAAACAACAAAC
AAGAGAG
260359/372359/372/260 (only II or III)
DodecaDodecaDodeca
GAACAGAACATGTTCGAACAGAACATGTTCGAACAGAACATGTTC
IIIAATAT
AATAG
AAGAG
359/372/260359/372359/372/260 (only II or III)
Prod
DodecaDodecaDodecaDodeca
AACAAAC
GAACAGAACATGTTCGAACAGAACATGTTCGAACAGAACATGTTC
AACAC
IVAATATAATATAATATAATAT
AAGAG
AATAGAATAG
AATAC
TAGA
  • a Indicates a sequence that is obviously low in abundance.