Table 5 Sequence analysis of oligonucleotide donors
Oligonucleotide30 bp UpstreamLoxP Sequence30 bp Downstream
LoxP4 oligonucleotideTCCATTACATTAGCATGTGCAGTGGCCATGATAACTTCGTATAGCATACATTATACGAAGTTATGTCAGGGTGTGGAGCGTTTTGGGAGCTTTA
TCCATTACATTAGCATGTGCAGTGGCCATGATAACTTCGTATAGCATACATTATACGAAGTTATGTCAGGGTGTGGAGCGTTTTGGGAGCTTTA
TCCATTACATTAGCATGTGCAGTGGCCATGATAACTTCGTATAGCATACATTATACGAAGTTATGTCAGGGTGTGGAGCGTTTTGGGAGCTTTA
TCCATTACATTAGCATGTGCAGTGGCCATGATAA__TCGTATAGCATACATTATACGAAGTTATGTCAGGGTGTGGAGCGTTTTGGGAGCTTTA
TCCATTACAT_AGCATGTGCAGTGGCCATGATAACTTCGTATAGCATACATTATACGAAGTTATGTCAGGGTGTGGAGCGTTT_GGGAGCTTTA
TCCATTACATTAGCATGTGCAGTGGCCATG_TAACTTCGTATAGCATACATTATACGAAGTTATGTCAGGGTGTGGAGCGTTTTGGGAGCTTTA
TCCATTACATTAGCATGTGCAGTGGCCATGATAACTTCGTATAGCATACATTATACGAAGT_ATGTCAGGGTGTGGAGCGTTTTGGGAGCTTTA
TCCATTACATTAGCATGTGCAGTGGCCATGATAACTTCGTATAGCATACATTATACGAAGTTATGTCAGGGTGTGGAGCGTTTTGGGAGCTTTA
TCCATTACATTAGCATGTGCAGTGGCCATGATAACTTCGTATAGCATACATTATACGAAGTTATGTCAGGGTGTGGAGCGTTTTGGGAGCTTTA
TCCATTACATTAGCATGTGCAGTGGCCATGATAACTTCGTATAGCATACATTATACGAAGTTATGTCAGGGTGTGGAGCGTTTTGGGAGCTTTA
LoxP5 oligonucleotideTTGCAGAGGACCTGGGTTTGGTTCCTAGCTATAACTTCGTATAG_ATACATTATACGAAGTTATCACTGGCATCTAACAGCCATCTCTACCTCC
TTGCAGAGGACCTGGGTTTGGTTCCTAGCTATAACTTCGTATAGCATACATTATACGAAGTTATCACTGGCATCTAACAGCCATCTCTACCTCC
TTGCAGAGGACCTGGGTTTGGTTCCTAGCTATAACTTCGTATAGCATACATTATACGAAGTTATCACTGGCATCTAACAGCCATCTCTACCTCC
TTGCAGAGGAC_TGGGTTTGGTTCCTAGCTATAACTTCGTATAGCATACATTATACGAAGTTATCACTGGCATCTAACAGCCATCTCTACCTCC
TTGCAGAGGACCTGGGTTTGGTTCCTAGCTATAACTTCGTATAGCATACATTATACGAAGTTATCACTGGCATCTAACAGCCATCTCTACCTCC
TTGCAGAGGACCTGGGTTTGGTTCCTAGCTATAACTTCGTATAGCATACATTATACGAAGTTATCACTGGCATCTAACAGCCATCTCTACCTCC
TTGCAGAGGACCTGGGTTTGGTTCCTAGCTATAACTTCGTATAGCATACATTATACGAAGTTATCACTGGCATCTAACAGCCATCTCTACCTCC
TTGCAGAGGACCTGGGTTTGGTTCCTAGCTATAACTTCGTATAGCATACATTATACGAAGTTATCACTGGCATCTAACAGCCATCTCTACCTCC
TTGCAGAGGACCTGGGTTTGGTTCCTAGCTATAACTTCGTATAGCATACATTATACGAAGTTATCACTGGCACCTAACAGCCATCTCTACCTCC
  • Both loxP4 (194 bp, top) and loxP5 (193 bp, bottom) oligonucleotide donors were cloned, and 10 clones of loxP4 oligo donor and nine clones of loxP5 donor were sequenced. A series of 1- or 2-bp deletions were identified in both oligonucleotides with a 1-bp substitution was present in the loxp5 oligonucleotide. Observed mutation or substitutions are shown in gray.