Table 1 CRISPR gRNA sequences
gRNA sequencePAM
gRNA-1(g1)CTTTTCTGTGCCATTCTCCAAGG
gRNA-2(g2)AGCACAGAGGAGTTCCTCTGAGG
gRNA-3(g3)ACACGCTGCTTTCATAGTCCAATGG
  • gRNA, guide RNA; PAM, protospacer adjacent motif.