Table 1 Primers used for quantitative RT-PCR
TargetLocusPrimer Sequence (5′ to 3′)
TIR1AT3G62980ATCGCTGCCACTTGCAGGAATC
TGGCCACTAACGTCGTCAACATC
AFB1AT4G03190GCTACTGTCCGAATGCCTGATCTTG
GCCTTGTTCCGTCAGAGGTATGTTG
AFB2AT3G26810GCCGCTAATTGCAGGCATCTTC
AGTCGTGCAAGTGTCTGGGAAAC
AFB3AT1G12820AGGTTGAAGCGGATGGTTGTAACAG
GCAAGTCCAGCTCACGAAGATGC
AFB4-aAT4G24390CCAAGACCAGCTCCTTTTTCACCT
AFB4-1CAAGGACCTTTAGCTGcCTGCATT
AFB4-bTTGGTCTGCTGTGAAGGTTTTGG
AFB4-2TCGAGTCAAGAgCCCAGAAGACTC
AFB4-cTGCTCAAGCCCATCATAAGCAAC
AFB5-aAT5G49980TCTTGGTTTGTTGTGAAGGTTTTGGT
AFB5-1AATCAAGCACTTTCAGCTTTcTGCAC
AFB5-2GAATCAAGGGCcCAGAACACCT
AFB5-bAGCCCATCATACTCAATTGCCACA
AFB5-cTGCCAACAAGTGCAgAAAGCTG
AFB5-3TCCACTTCATCATCCGTGACCTC
PP2AA3-SAT1G13320GTGGCCAAAATGATGCAATCTCTC
PP2AA3-LAACTTGCTGAAGACAGGCACTGGA
PP2AA3-RATGTTCTCCACAACCGCTTGGTC