Table 1 Primer sequences for generating RPG reporter plasmid
GeneForward PrimerReverse Primer
PPARCCCgcggccgc TTCTTCAGCCATCAGGTTTGGGCCCggatcc CCTTGGCTTTGGTCAGAGGG
ATP5ECGCgcggccgc GTTTTCAGCTACATCCGGTACTCCGCggatcc CCTTCTTGGTCTTCACAATCTTC
OVACCCgcggccgc AGAGTTCACCATGGGCTCCATCCCCggatcc GTATACCATGGCTAGAGCTGAC