Table 2 Primers used in sequence analysis for detection of indels
GeneForward PrimerReverse PrimerProduct Size
PPARAAGCGCTTCAGTAGTTTGCCTTGTGGAAGATAACCTCTGG673 bp
ATP5ECATGGTGGCGTACTGGCGGCAGGCTGAGCTGCTCGCTGCATGTGCAGTG546 bp
OVATAGCCTACCATAGAGTACCCTGCAACTGCTGGATGCAGAGCACTAGC697 bp