Table 3 Primer sequences for detection of off-target analysis
GeneForward PrimerReverse PrimerProduct Size
GNSAGCCCCACAGATAGCTGTCTTCACGCCAGCCACTCCTTC544 bp
EHD3GAGGTTGTGACTCAGTCAGCACCACATACATTATCCGAGCCCG627 bp
ADCYAP1GAAATGGAGCAAACAGAGAGCGTCCTTCATTTGTACTCAGG626 bp
KCNT2CCTCCCCAACAATCACCTCTTCCCGCTGGGGAAGAAGCAGACA610 bp
DAD1CTCACACAAGGGCACCTCTGGATAGCTACGGGGCTTCGTG636 bp
PITPNM2GCTGGATCTGTGCATACAAGGGGTTCATACATGCCATGAC597 bp
ABCC9GGCTACTTGGGTACTGCACTCCAGTTGCTGCAAAGATCACGC388 bp
TXNDC12CATGCTGACCCGGAAGTGACCCGTACACTGATTGATGTGGTG363 bp
LCP2ACCTGAGCCAAGCCTGACTCTAGGGAGCTGGATTCATTTTCC387 bp