Table 1 Primers used in this study indicating different annealing temperatures for each primer pair
F. circinatum GeneNameSequence 5′-3′Annealing Temperatures
FCIRG_14470FCIRG_14470FCCTCTTCCGCCTCAACTA55
FCIRG_14470RGAGCCGTTTAGCGACCTG
FCIRG_06550FCIRG_06550FCCCTCCCAGCAACCACCG57
FCIRG_06550RCGACCGTTTCCTGGCTGACC
FCIRG_06217FCIRG_06217FAGAGGTCCCAGTAGCAGTAG54
FCIRG_06217RGCACCTTGTCTTCCTCGG
FCIRG_05181FCIRG_05181FCGCAGACGCTGAAGAAAA57
FCIRG_05181RTGGCAGGTTGACAGTGAAAT
FCIRG_10575FCIRG_10575FTCTCGGAATAGGTCTTGTATCAGC58
FCIRG_10575RCCTGGCGAGGCGACATTAGC