Table 4 ChIP-qPCR primers
Primer NameSequence
Bab2_ChIP_T13_FTATTTGCGTGGAGCCTTC
Bab2_ChIP_T13_RTAACGATTGCCGCGATTT
Or82a_ChIP_M1_FCACAGTACATACAGCCATACAG
Or82a_ChIP_M1_RCGCTTCCTTCTGCTTGTT