Table 2 Oligonucleotide Primers
NameSequence (5′ to 3′)a
OAD20GCGTTCATTATCGCCCAATGTG
OAD21GCGCTTGATCAGCAGTTCATCG
OAD476GAAACTATTGGCACGCCCTA
OAD477CCTGCGAATCAACCGATACT
OAD479TATGGCTCGGTGTCAAAACA
OAD480CATGGTTTCTTGCCGGTTAT
L61MforCCAAAAATCTACTGAACTGaTGATCAGAAAGTTACC
L61MrevGGTAACTTTCTGATCAtCAGTTCAGTAGATTTTTGG
L61FforCCAAAAATCTACTGAACTGTTcATCAGAAAGTTACC
L61FrevGGTAACTTTCTGATgAACAGTTCAGTAGATTTTTGG
L61CforCCAAAAATCTACTGAACTGTgtATCAGAAAGTTACC
L61CrevGGTAACTTTCTGATacACAGTTCAGTAGATTTTTGG
L61GforCCAAAAATCTACTGAACTGggGATCAGAAAGTTACC
L61GrevGGTAACTTTCTGATCccCAGTTCAGTAGATTTTTGG
L61QforCCAAAAATCTACTGAACTGcaGATCAGAAAGTTACC
L61QrevGGTAACTTTCTGATCtgCAGTTCAGTAGATTTTTGG
L61NforCCAAAAATCTACTGAACTGaatATCAGAAAGTTACC
L61NrevGGTAACTTTCTGATattCAGTTCAGTAGATTTTTGG
L61SforCCAAAAATCTACTGAACTGTcGATCAGAAAGTTACC
L61SrevGGTAACTTTCTGATCgACAGTTCAGTAGATTTTTGG
L61AforCCAAAAATCTACTGAACTGgcGATCAGAAAGTTACC
L61ArevGGTAACTTTCTGATCgcCAGTTCAGTAGATTTTTGG
L61IforCCAAAAATCTACTGAACTGaTtATCAGAAAGTTACC
L61IrevGGTAACTTTCTGATaAtCAGTTCAGTAGATTTTTGG
L61YforCCAAAAATCTACTGAACTGTatATCAGAAAGTTACC
L61YrevGGTAACTTTCTGATatACAGTTCAGTAGATTTTTGG
L61EforCCAAAAATCTACTGAACTGgaGATCAGAAAGTTACC
L61ErevGGTAACTTTCTGATCtcCAGTTCAGTAGATTTTTGG
L61HforCCAAAAATCTACTGAACTGcatATCAGAAAGTTACC
L61HrevGGTAACTTTCTGATatgCAGTTCAGTAGATTTTTGG
L61TforCCAAAAATCTACTGAACTGacGATCAGAAAGTTACC
L61TrevGGTAACTTTCTGATCgtCAGTTCAGTAGATTTTTGG
L61KforCCAAAAATCTACTGAACTGaaGATCAGAAAGTTACC
L61KrevGGTAACTTTCTGATCttCAGTTCAGTAGATTTTTGG
L61WforCCAAAAATCTACTGAACTGTgGATCAGAAAGTTACC
L61WrevGGTAACTTTCTGATCcACAGTTCAGTAGATTTTTGG
L61PforCCAAAAATCTACTGAACTGccGATCAGAAAGTTACC
L61PrevGGTAACTTTCTGATCggCAGTTCAGTAGATTTTTGG
L61RforCCAAAAATCTACTGAACTGcgGATCAGAAAGTTACC
L61RrevGGTAACTTTCTGATCcgCAGTTCAGTAGATTTTTGG
L61DforCCAAAAATCTACTGAACTGgatATCAGAAAGTTACC
L61DrevGGTAACTTTCTGATatcCAGTTCAGTAGATTTTTGG
  • a The lowercase letters represent nucleotides that differ from those present in the wild-type HHT2 gene that alter the wild-type H3-L61-encoding codon (TTG) to a different one encoding the corresponding H3-L61X mutant.