Table 2 RAD markers showing significant association with disease resistance
MarkerAssociationP ValueBLUPLGMarker Sequence
R45138CWD1.49E-051.78E-01WS08/Omy16aTGGTCGCAAGGGGAAACATAGCCGCCATAGGCATCCTAAGCCTTTTAGGGC[T/A]GCAAAAC
R46743CWD5.31E-049.13E-03WS08/Omy16aTTCATTCTCAACAACATCCAT[G/A]GAGTATGACCTTACCTCACAGAGGAAGCGGCGCAGGT
R26956CWD6.33E-041.23E-01WS23/Omy17GGAGGAAGAGAGGATGTGGGGGAGGAAGAGAGGATGTGGG[G/A]GAGGTTGGAAACATGATT
R46637CWD1.77E-03−5.24E-02WS05/Omy8bCCTTGGTAGTGGGCCGTGTCGGTGGCACTG[T/C]ATTATCCTCAAAGCTGGTAAAGAAGGTG
R08795CWD1.91E-031.42E-01Omy29+CCACTTTCTGTCGCTCTCTTTGTCTCAGTCATTCCCTTTCTT[G/T]TGATTTCTTTCCCTTC
R13883CWD2.79E-03−1.43E-01WS13/Omy06TGCAGTTCTGAAGGTTGATTCAGCAGTATTTGGGGCATCGAAGTGATGGGACAT[A/G]TGAC
R49259CWD3.06E-031.49E-01NAAAATCACGCACAGAACAAGC[A/T]GTACGGCTGGTGGTATTGTCATGCTTGAAGGTCATGTC
R34531CWD3.29E-03−5.92E-02WS13/Omy06a,cTGATGCCCATGGCCTTGATCTTGGCCGA[T/C]TCGCTGCCCAGCTCGTTCAACTGCTGTTTA
R40622CWD3.52E-037.22E-02WS01/Omy04AGAGTAGA[C/T]CTCCAGGAACAGGTTAGGCCACCACTGACAAAGAACATCCAGCATTAGAG
R46597CWD3.99E-037.56E-02WS23/Omy17[C/T]GGTTTAGGACCTTTGTAATGACTTTCATTTAGCTAGCGCAAGTATTTGGTTCTGGGTT
R20199CWD4.03E-031.14E-01WS01/Omy04aAAGGGTAACACATTTCCTGGGTTATTCAACTGGCCCCTCCGTCG[C/T]GACGTCCTCTGAAT
R53165CWD4.45E-03−2.64E-02WS04/Omy9bTCTGTGACATCAACATGCTGTTTTCCTCAGTAGGGTCATGCAAAAACAAATG[T/G]CACCTT
R21407IHNV5.98E-055.24E-02WS13/Omy06aGAGTGAGAATGGAGGACAAGAAGGTAGATG[G/C]GGTAAGGCCATGGCCAGTCCCAACCACC
R14353IHNV9.52E-05−1.33E-01WS13/Omy06aAGTACATAACATGAC[C/T]GTACATATTTAATATGCTATTCAAGTGTTTTAAGACACCAATA
R24813IHNV8.95E-047.86E-02WS13/Omy06a,cTTTGACTCCTGATGAATGCCCCGTCTGCGGAATCTCTCTTGCTCGCTCTCTC[A/G]GCAATC
R53135IHNV9.53E-04−1.23E-01NACACATTGCCTGGTGGCGTTTATTAATGTTTACATACTGTACCGTTT[A/C]TTTTTTTTTAAA
R03138IHNV1.01E-039.38E-03WS13/Omy06a,c,dTGCCCGGCCCGCCACAAGGAGTCGCTTGA[A/G]CGAGTAAAGTCCCCCTGGTTGTGATACAG
R39227IHNV1.45E-031.49E-01WS07/Omy11dC[C/A]TCCAGCTGCCTGCCTCACAGGCCAAATATGCTATTTAGAAAATTGGGATATAAGAGA
R53350IHNV1.63E-03−1.53E-02WS13/Omy06aCCAAACTCTCCCCTAACCCGGACGACGCTGGGAAAATTGTA[C/T]GCCGCCCTATGGGTCTC
R52586IHNV1.66E-035.55E-02WS28/Omy26TAGACTGTAC[T/C]AAGAGCTGAATCACAACTCCTGTATGGATAACACCACACTGGTCAAGT
R46528IHNV1.78E-03−6.56E-02WS24/Omy25AGTGAGTCACTG[C/A]TTTGATGTTTGCAGAGCACGACAGAGTGTTGTGCAGGGTCATTGCA
R48860IHNV2.44E-031.37E-01WS14/Omy10CGCTCGCCC[T/C]GCCACAAGGAGTCGTTAGAACGCGATGAGCCAAGTAAAGCCCCCCAAGG
R33079IHNV2.46E-03−1.16E-02WS13/Omy06a,dCCATGGGCAACCTCACCCCTCTCCATAC[C/G]CCTACTCCTCCACAGTCCCCTCAGAGCTCA
R52674IHNV2.54E-03−6.30E-02WS13/Omy06aGGACCCACCAATCCTGAAGAAGTTAAAGACTCCAGCCATTCAAGC[C/A]ATAGACTGGCTGG
R19689IHNV3.29E-031.14E-01WS03/Omy05ATCATCTGAGACCAGCCACCCAGACAGCTGTGGGTTTGTGGGTTTGCACAACCAAATA[A/T]
R04597IHNV4.07E-03−7.38E-02WS03/Omy05aCTCATCCTGACATGACCCTGCAGCTTGACAATGTCACCAGCCATACT[G/A]CTCGTTCTGAG
R14972IHNV4.19E-031.80E-02WS13/Omy06aCTACCACTCTTTCCCCAAGTAAGTA[T/C]CCGGGTGAATGGTTAAACAACTAGCCTAAACAG
R18850IHNV4.19E-03−8.30E-02NATCTGGTGTCAGAATGCGCA[C/A]GGAGCTCCTCAGTGGATTACTTCTGGTACAGAGAGACAC
R45284IHNV4.37E-037.09E-02WS29/Omy13aCTACTATTAAAGTATCACTGCTTTGGTGTGTAATTCCAAT[G/A]CCCCTTTATCTTTTAAGT
R05136IHNV4.87E-03−2.22E-02WS14/Omy10a,cACGGG[A/T]ATCACAATAGGGAGGAGGATGTCTTCCCTGTAATGCACAGTGTTAAGATTGCC
R52799IHNV5.16E-03−1.76E-01NAGCTACAGACAGAC[T/G]ATCACTCTATCATGGTAGGATGGATGGAGGGAGGGAGCACATCAC
  • Linkage group (LG) names are as reported by Miller et al. (2011)/Palti et al. (2011). The two bold and underlined loci align to the same contig in the O. mykiss draft genome. Marker sequences follow the SbfI recognition sequence “CCTGCAGG.” CWD, cold water disease; IHNV, infectious hematopoietic necrosis virus; RAD, restriction site−associated sequencing; BLUP, best linear unbiased predictor.

  • a LG confirmed by alignment to Berthelot et al. (2014) O. mykiss genome.

  • b Directly matches mapped RAD locus from Miller et al. (2011).

  • c LG assignment supported by Berthelot et al. (2014) O. mykiss genomoe alignment only.

  • d LG assignment confirmed by alignment to same draft genome contig as previously mapped RAD marker.