Table 1 Candidate genes and SNP markers at the major sex determining region of turbot (through comparative mapping against the stickleback LGVIII chromosome
GeneStickleback Genome Position, bpAccession No.External PrimersInternal PrimerAmplicon Size, pbMarker Position
dnaj196068380 - 6070562KJ434933F: GCCGTGAAGCAGATGGAGF: CCACCGGTGATAGTTGTGG392Third intron
R: GGGAAACAATCAATGGATCA
sox26157588 - 6158556KJ434936F: AGGAAAGTCTCCTGGAAGGAAR: GTCCCTTTTTCTTTCCAATGTG6623′ UTR
R: CAGATGAAAAGTGGGAGACG
atp11b6308502 - 6339588KJ434932F: AGACTCATTTCTGGACGTGGAF: GTGGACATGCAGTAGAATAACTGG37030th intron
R: CACCACGTCGGGAAAGAG
dlg16549844 - 6552127KJ434935F: CAGGAAGAGACTCTGCTCACCR: TCTTTAAATCCACACTGGGTGATAC370Third intron
R: GAATGGAAGTTTGACGTTGGA
fkbp26565695 - 6568855KJ434934F: CGAGAAGAGGAAGCTCGTCAF: TTCCCCAAGTTCTGACTTTGAG334Intron
R: TTGGATGGAGCAAATCTACTGA
ncbp26569593 - 6572048KJ434931F: GCGTTGATCAGCGACTCCTAR: CCGTGTTTGCTAACGGCT352First intron
R: GCAATGAGTCCGAACACAAA
  • SNP, single-nucleotide polymorphism; LG, linkage group; UTR, untranslated region.