Table 2 Heritable mutation rates of sgRNAs with the wild-type Cas9 or Cas9H840A nickase
Gene Name (CG#)sgRNA Offset (bp)*sgRNA NamesgRNA Target SequenceHeritable Mutation Rate (%)**
With Cas9With Cas9H840ABoth sgRNAs with Cas9H840A
white (CG2759)−88white-KGCTGCATTAACCAGGGCTTC64.1ND0.8
white-SGAGGACTCCGGTTCAGGGAG78.50
−84white-FCGCCGGAGGACTCCGGTTCA18.100.8
white-LCCAAAAACTACGGCACGCTC78.60
−69white-KGCTGCATTAACCAGGGCTTC64.1ND0.8
white-PCCTCCGGCGGACTGGGTGGC80.20
−68white-FCGCCGGAGGACTCCGGTTCA18.101.1
white-MGCTCCGGCCACCCAGTCCGC63.60
−42white-SGAGGACTCCGGTTCAGGGAG78.501.0
white-NCCGGCCACCCAGTCCGCCGG33.20
−35white-ETAGTTGGCCGCTCCCTGAAC32.301.5
white-FCGCCGGAGGACTCCGGTTCA18.10
−15white-DAGGTGAGGTTCTCGGCTAGT57.100
white-RCCGAGAACCTCACCTATGCC58.60
−5white-DAGGTGAGGTTCTCGGCTAGT57.100
white-HCACCTATGCCTGGCACAATA42.4ND
−1white-QGATCCTCTTGGCCCATTGCC52.6ND0
white-BCAGGAGCTATTAATTCGCGG61.80
1white-ETAGTTGGCCGCTCCCTGAAC32.300
white-RCCGAGAACCTCACCTATGCC58.60
7white-DAGGTGAGGTTCTCGGCTAGT57.100
white-CGCACAATATGGACATCTTTG43.70
11white-ETAGTTGGCCGCTCCCTGAAC32.300
white-HCACCTATGCCTGGCACAATA42.4ND
22white-ETAGTTGGCCGCTCCCTGAAC32.300
white-IGGCACAATATGGACATCTTT52.10
  • ND, Not done.

  • * Offset distance of a given sgRNA pair is measured from PAM-distal end of an sgRNA to that of the other. When the PAMs are facing outward relative to each other, the distance is a positive number. If the PAMs are facing inward toward each other, then the distance is a negative number.

  • ** The heritable mutation rate is calculated as the number of white-eyed F1s divided by the number of all F1s observed.