Table 1 Heritable mutation rates of sgRNAs with the wild-type Cas9 or Cas9D10A nickase
Gene Name (CG#)sgRNA Offset (bp)*sgRNA NamesgRNA Target SequenceHeritable Mutation Rate (%)**
With Cas9With Cas9D10ABoth sgRNAs with Cas9D10A
white (CG2759)−364white-JCTGCGGCGATCGAAAGGCAA57.1ND0
white-FCGCCGGAGGACTCCGGTTCA18.1ND
−95white-ETAGTTGGCCGCTCCCTGAAC32.300
white-KGCTGCATTAACCAGGGCTTC64.1ND
−68white-ETAGTTGGCCGCTCCCTGAAC32.300
white-LCCAAAAACTACGGCACGCTC78.60
−35white-ETAGTTGGCCGCTCCCTGAAC32.300
white-FCGCCGGAGGACTCCGGTTCA18.1ND
−15white-DAGGTGAGGTTCTCGGCTAGT57.1<0.1%0.2
white-RCCGAGAACCTCACCTATGCC58.60
−5white-DAGGTGAGGTTCTCGGCTAGT57.1<0.1%0
white-HCACCTATGCCTGGCACAATA42.4ND
−1white-QGATCCTCTTGGCCCATTGCC52.6ND3.2
white-BCAGGAGCTATTAATTCGCGG61.8<0.1%
1white-ETAGTTGGCCGCTCCCTGAAC32.3015.9
white-RCCGAGAACCTCACCTATGCC58.60
6white-DAGGTGAGGTTCTCGGCTAGT57.1<0.1%6.6
white-IGGCACAATATGGACATCTTT52.10
7white-DAGGTGAGGTTCTCGGCTAGT57.1<0.1%21.2
white-CGCACAATATGGACATCTTTG43.70
11white-ETAGTTGGCCGCTCCCTGAAC32.3011.3
white-HCACCTATGCCTGGCACAATA42.4ND
22white-ETAGTTGGCCGCTCCCTGAAC32.3016.9
white-IGGCACAATATGGACATCTTT52.10
26white-ETAGTTGGCCGCTCCCTGAAC32.303.6
white-ACAATATGGACATCTTTGGGG81.60
61white-FCGCCGGAGGACTCCGGTTCA18.1ND0
white-ACAATATGGACATCTTTGGGG81.60
112white-ETAGTTGGCCGCTCCCTGAAC32.300
white-GAGCGACACATACCGGCGCCC80.1<0.1%
217white-ETAGTTGGCCGCTCCCTGAAC32.300
white-ACAATATGGACATCTTTGGGG81.60
432white-ETAGTTGGCCGCTCCCTGAAC32.300
white-OTTATCGGCTCCCTAACGGCC71.4ND
  • ND, Not done.

  • * Offset distance of a given sgRNA pair is measured from PAM-distal end of an sgRNA to that of the other. When the PAMs are facing outward relative to each other, the distance is a positive number. If the PAMs are facing inward toward each other, then the distance is a negative number.

  • ** The heritable mutation rate is calculated as the number of white-eyed F1s divided by the number of all F1s observed.