Table 1 Primer design
Primer Name5′-End Taila3′-End Homology
ORF-specific P1 FF-strand promoter (~ −1022 to −1000)b
ORF-specific P2 Rbar: ttaggtcgacR-strand promoter (~ −500 to −522)c
ORF-specific P3 FF-strand promoter (~ −510 to −500)bar: gtcgacctaaatctcggtgac
Universal P4 Rbar: atcgtcaaccactacatcgaga
Universal P5 Fbar: ggagacgtacacggtcgact
ORF-specific P6 RR-strand YFG ORF (+10 to +1)R Promoter tcu-1: GGTTGGGGATGTGTGTGCGA
ORF-specific P7 FF promoter tcu-1: ATCCCCAACCF strand YFG ORF (+1 to +20)
ORF-specific P8 RR-strand YFG ORF (~ −522 to +500)
ORF-specific P9 FF-strand promoter (~ −1050 to −1030)
ORF-specific P10 RR-strand YFG ORF (∼ +550 to +530)
  • ORF, open reading frame; YFG = “your favorite gene.”

  • a Each primer is composed of a 5′ end tail (if needed) fused to the 3′ end homology sequence and is listed in the 5′ to 3′ direction. The gene region that the sequence corresponds to is indicated, followed by the sequence. For gene specific sequences the recommended region to obtain the sequence is listed.

  • b The numbers denote the recommended distance in bp from the start codon, with negative numbers upstream and positive numbers downstream. If known control sequences in your target must be deleted, then these numbers will need to be altered accordingly.

  • c Use of this position in the 5′ UTR will delete 500 bp upstream of the ATG.