Table 3 Primers used in this study
Oligo NumberDescriptionSequence (5′->3′)
NATR cassette
2540ScTEF1p, forcaaggagctcCATAGCTTCAAAATGTTTCTACTCC
2541ScTEF1p, revcgcggatccAAAACTTAGATTAGATTGCTATGC
2542NAT1 orf, forctagagatctAAAATGGGCACCACTCTTGACG
2543NAT1 orf, revacgcgtcgacTTAGGGGCAGGGCATGCTCATG
pBM16.1 MCS
MCS, foraattgagagctcgaccatcaagggtaccttgca
MCS, revaggtacccttgatggtcgagctctc
Constitutive promoters
4634EGD2p, foraaaagagctcTGTCCACTTCACTCACCAGT
4636EGD2p, revaaaatctagaCTTTGTATATCTGTATTATTG
4637HHT2p, foraaaagagctcTGTTATTGATTATTTATTTATTTG
4638HHT2p, revaaaatctagaTATGTATGTGTTGTGTTTTG
4639PDC1p, foraaaagagctcAGCATTTTTATACACGTTTTAC
4640PDC1p, revaaaatctagaTGTTAATGTTTTTTGGCAATTG
Macrophage-induced promoters
5114ACO2p, forattagagctcCTGCAGTGTCCCGTTTGTTTC
5115ACO2p, revattatctagaTGCTAGTGGGTACGAATTGTAG
5120LYS21p, forattagagctcAGAAAGCGAAGAAGATATATC
5121LYS21p, revattaactagtCTTTAATATTCTTTGTTCAGC
Nutritionally regulated promoters
4036MET3p, forcttgagagctcATACCAGTTACAATTAGTATTACAATGGTTTAC
4035MET3p, revgctctagaTTGTTAGGTGTTTCTTTTCTGGAGTGTTA
qRT-PCR primers
5980GFP, forCCACTCAATCTGCCTTATC
5981GFP, revATCCATACCATGGGTAATAC
5883TUB1, forGGTGATGTGGTAACAAGAGATG
5884TUB1, revGTAGCAGATACCGATCTTGAAAC
6426TUB1, rev 2TCGTAGCAGATACCGATCTTGAA
6597ApR gene, forAAGCCATACCAAACGACGAG
6598ApR gene, revTTGCCGGGAAGCTAGAGTAA
  • The DNA sequences of primers used in this article are listed. Capital letters in the DNA sequence hybridize to the target sequence; linkers and restrictions sites added are written in lowercase letters. NATR, nourseothricin-resistant; for, forward; rev, reverse; qRT-PCR, quanitative reverse-transcription polymerase chain reaction.