Table 2 Major primers used in this investigation
Target GenePrimer NameSequence (5′-3′)
Regular PCR
 SLA of G. clavigeraERGCCACGTCGTTCAACAACTA
 Hypothetical protein (CMQ_5309 ofUP2-2FAGATGGTCATCTCCCGTGAC
  G. clavigera)
UP2-2RAGATGGTCATCTCCCGTGAC
 HMG domain in G. clavigeraHMG1CCGCGCCCACCCAATGCGTACAT
HMG2CGAGGGTTGTATCTGTAGTCAGG
 alpha-box domain in G. clavigeraMAT1x1CGTCCACTGAATGCCTTCATG
MAT1x2GTGGGCAATCATAGCCAAAGT
 Cytochrome C oxidase of G. clavigeraCOX13AGCTTGACGCAACTATCTCTGC
COX13BTGCATCCCCTACTCGATACAC
 DNA lyase (APN) of G. clavigeracAPNRGATTCCTTTTACAGCTTTCCCCAC
APN2RGACGAGGAGCTGCATCAGG
APN3FGACAGGATCACGAACACAACC
APN3RTCTTCGATTGGCTCTTTAGGG
 SLA of O. montiumOM7RCAACACGCTCATTGAGAC
 HMG domain in O. montiumOM-HMG1CGCCCCCCCAATGCCTACATTC
OM-HMG2CGGGGATTGTACTTGTAGTGCGG
 alpha-box domain in O. montiumOM-A1GAATGCCTTCATGGCCTTCC
OM-A2ACCTTTGCCATCAACGTCCATTT
Real-time PCR
 truncated MAT1-1-1pMF2GATCAGATGGGCAAGCTCAG
pMR2AAGGCTTGGAAGGACGTGTT
  • PCR, polymerase chain reaction.