Table 2 Primers used in this study
NameSequences (5′-3′)aUsage
1610-FTCAAGGAGAAGGGCTACAGgenerating standard fragment for qPCR in the TTC1610 region
1610-RCCTTGTAGCTCACGGAAAC
1610-F-1ACGCCATCCTGGTCAAGGTGprimers of qPCR reactions for detecting TTC1610 copy numbers
1610-R-1AGGTCGGCGATGAAGCTGTC
0574-FCCGGCAGGTAGACGTCAAAGgenerating standard fragment for qPCR in the TTC0574 region
0574-RTGAGCCGGAGGGAGTTTGAG
0574-F-1GTGACCACCACGCTTTCGGGprimers of qPCR reactions for detecting TTC0574 copy numbers
0574-R-1TTAGGCCGCCAGGATCAGTACG
bglF1-FtgcatgcctgcaggtcgactAGACCATCCCCCAGGAGCTCamplifying bgl upstream flanking region for pUC-Δ42
bglF1-RcctctggcggggcacttagCTCGGTCATAGGCGTTTCTC
bglF2-FgagaaacgcctatgaccgagCTAAGTGCCCCGCCAGAGGamplifying bgl downstream flanking region for pUC-Δ42
bglF2-RgctcggtacccggggatcctGCCAGAACCAGAACGAAAAG
dbgl-FGCCGTCTACATCTTCCTCACPCR determination of bgl deletion
dbgl-RTACCTTCCCGAGGACATCAC
pCT3FKm-Zra-FACCTGCAGACGTCCAAGCTTGGCACTGGCCGTCGTTTTACAAsite-directed mutagenesis of pCT3FK
pCT3FKm-Zra-RTTTCAGCAGACGTCGTTTCCTTTCTTTTCAGAGGGTATTTTA
pyr.FCCGAGCCCTTGGCCCATATCcloning of the pyrFE region
pyr.RCAGGACCGCCACCCTCATA
pyrEm-Nde.FGAGGAAGCGCATATGAGACCTCCTCCsite-directed mutagenesis of pJ-pyrFE
pyrEm-Nde.RCAGGACGTCCATATGCCCCTACTCTAC
pyrF.RGGACCCTCCCGGTACCTTTCcombing with pyr.F used for probe generation for Southern blot
pyr.R2GCTTTCCAGGTTGACGGTAAGCcombing with pyr.F used for PCR detection of pyrE gene replacements
mreB-1-FcatgcctgcaggtcgactAAACGGGACCGATTCCTCamplifying mreB downstream flanking region for pUC-ΔmreB::kat
mreB-1-RagagcgcccaatacgcaaaccGAGCTCGCCTCGGACATCTAC
mreB-2-FcttggaggagaaacgccTGCCGATGTCTTCGCCTTTAAGCamplifying mreB upstream flanking region for pUC-ΔmreB::kat, and Southern blot probe template generation for mreB deletion detection
mreB-2-RcggtacccggggatcctGGGTGGACCTCATCATTGAC
kat-FcggtttgcgtattgggcgctctTCCCCGGGAGTATAACAGAAACCamplifying kat for pUC-ΔmreB::kat
kat-RggcgtttctcctccaagAATTCCGTTCAAAATGGTATG
dmreB-FTTGAGGATCTCCCGGATGTCPCR determination of mreB deletion
dmreB-RATCGCGAGCCGCATTGAGAA
parA-F1-FtgcatgcctgcaggtcgactTCCTCCAAGGAGCGGTACTGamplifying parA upstream flanking region for pUC-ΔparA::blm
parA-F1-RgttatactcccggggatcccCCTGGCAGAGGAGGTGATGG
parA-F2-FgactgatctagaggatccccGCCCTTAGCATAACGGATACamplifying parA downstream flanking region for pUC-ΔparA::blm
parA-F2-RcggtacccggggatcctCAAGTACGCGGGCTACATTG
blm-FGGGATCCCCGGGAGTATAACamplifying blm for pUC-ΔparA::blm
blm-RGGGGATCCTCTAGATCAGTC
probe-FCCTCGGCTTCCTCAAGCTCTTCSouthern blot probe template generation for parA deletion detection
probe-RCCGAAGAGGACGCGCACCGC
dparA-FTAGCGCCTTTCCCCCGCCACPCR determination of parA deletion
dparA-RACCTGGTGGTGTTGGAGAAG
  • a Enzyme restriction sites are in bold and sequences that create the overlaps for the Gibson assembly reactions are in lowercase.