Table 3 Correlation among quality scores from first six reads (Q1–Q6) of the same sequence of 50 nt (TGTTATCACGGGAGACACACGGCGGGTGCTAACGTCCGTCGTGAAGAGGG)
Q1Q2Q3Q4Q5
Q20.804889
Q30.6622420.873874
Q40.715940.9389510.918316
Q50.7849770.9680690.8646780.945969
Q60.6348080.8503720.9268040.9317040.866401
  • Each read is associated with a vector of 50 quality scores (one for each nucleotide).