Table 3 Primer sequences
PrimerSequence
(A) Cdc7-Sir4 Fusion ForwardATACAATCAACTCCAAGCTTGAAGCAAGCCTCCTGAAAGATGACAAGCAAAACGAAGAA
(B) Cdc7-Sir4 Fusion ReverseTTTGGGTTTGCTAGAATTAGTATCACTATGCGACACTCTTTCAGATATTAGGAGAACATCCTT
(C) Cdc7-Sir4 C-terminal deletion Fusion ReverseTTTGGGTTTGCTAGAATTAGTATCACTATGCGACACTCTTTCGAAGCATTGTTCCAAAACCTG
(D) Inverse PCR Forward Primer (OM8714)AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAATTCACTACGTCAACA
(E) Inverse PCR Illumina TruSeq Index Primer 1 (OM8827)CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTT
(F) Inverse PCR Illumina TruSeq Index Primer 2CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTT
(G) Inverse PCR Illumina TruSeq Index Primer 3CAAGCAGAAGACGGCATACGAGATGCCTAACGGTCTCGGCATTCCTGCTGAACCGCTCTT
(H) Inverse PCR Illumina TruSeq Index Primer 4CAAGCAGAAGACGGCATACGAGATTGGTCACGGTCTCGGCATTCCTGCTGAACCGCTCTT
(I) PE Read 2 Illumina Sequencing PrimerGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG
(J) Cdc7 N168A ForwardCATCAAACCGACAGCTTTTTTATTTAATTTGGAATTGGG
(K) Cdc7 N168A ReverseCAAATTAAATAAAAAAGCTGTCGGTTTGATGTCTCTATG
(L) Fusion Verification Forward Primer (OM6189)CACAATATTTCAAGCTATACC
(M) Fusion Verification Reverse Primer (OM6373)CTCATCAACCAACGAAACGG
(N) ARS306 ForwardTGCGAATTTCCTGTTCAGTG
(O) ARS306 ReverseTATTGGGATTGGGGGCTAAT
(P) ARS607 ForwardGGCTCGTGCATTAAGCTTGT
(Q) ARS607 ReverseGCAAATCAAAGGATCCCTCA
(R) ARS305 + 8 kb ForwardGGGTCTATGCCCTCGTGATA
(S) ARS305 + 8 kb ReverseATCATACCTCGCCAATCTCG
(T) ARS1 + 10 kb ForwardTGCTTTCAAGCTGGTCTTCA
(U) ARS1 + 10 kb ReverseTTTCTCTGCGCAGTTTTTCA