Table 1 Sequences of primer pairs for Sanger sequencing
GapPrimer Sequence (5′–3′)Amplicon Size (bp)
1G1F TCGGTCGAATACTCCGAAAG447
G1R CATGGGACTGTTCTGGACCT
2G2F CACTGCCAAATGTCAAAGCA436
G2R GGAGCGAGTATTGGCATTGT
3G3F GCGTATCCGTCAAGATTGGT844; 601a
G3R1 TACTCGGTGGCCTTGCTATT
G3R2 CTCAGGCTCGTTGGCTTATG
  • a Amplicon size from primer G3F to G3R1 is 844 bp, and the amplicon size from G3F to G3R2 is 601 bp.