Table 1 Information about KASP assays, including primer name (with linkage group, position on A. duranensis pesudomolecule, orientation, and dye), primer sequence and type, melting temperature, GC content, and SNP type amplification pattern
Primer Name (LG, Position_Orientation_Dye)aSequenceTypeTmGC%SNPAmplification patternb
Nem_Aradu.A02_76738828_Fwd_CAACTAAGCAACAGGAAAGACGAF58.9347.62(As = BatSten = GregSten) ≠ Ad ≠ (Ah = Am)*
Nem_Aradu.A02_76738828_Rev_FAMGAAGGTGACCAAGTTCATGCTGATCATTGTTGCCGAATCTCAS58.0945A
Nem_Aradu.A02_76738828_Rev_VICGAAGGTCGGAGTCAACGGATTGATCATTGTTGCCGAATCTTAS57.6140G
Nem_Aradu.A02_83608917_Fwd_TTTGTGGCTGCAATAACTTCAAF59.3638.1Ad ≠ (As = BatSten = GregSten = Ah = Am)
Nem_Aradu.A02_83608917_Rev_VICGAAGGTCGGAGTCAACGGATTCATGACATTGTAAGTGGCAAAAACAS60.6637.5G
Nem_Aradu.A02_83608917_Rev_FAMGAAGGTGACCAAGTTCATGCTCATGACATTGTAAGTGGCAAAAATAS60.1733.33A
Nem_Aradu.A02_84440546_Rev_GCGATTAATACATTCAACAACCAAF58.9334.78(As = BatSten = GregSten) ≠ (Ad = Ah = Am)*
Nem_Aradu.A02_84440546_Fwd_FAMGAAGGTGACCAAGTTCATGCTGCTCTCCTTCTTGGTGGTTTGAS61.1752.38A
Nem_Aradu.A02_84440546_Fwd_VICGAAGGTCGGAGTCAACGGATTGCTCTCCTTCTTGGTGGTTTAAS58.4547.62G
Nem_Aradu.A02_84440594_Rev_GGAAGCGGATTCCACTCAAF59.7255.56(As = BatSten = GregSten) ≠ Ad ≠ (Ah = Am)*
Nem_Aradu.A02_84440594_Fwd_FAMGAAGGTGACCAAGTTCATGCTGAAGTGTGTCATAATCTCCAAAGTGAS59.1240A
Nem_Aradu.A02_84440594_Fwd_VICGAAGGTCGGAGTCAACGGATTCTGAAGTGTGTCATAATCTCCAAAGTAAS6037.04G
DS_c1614_886_A02_88903581_Rev_AGCTGAGGAGAACCCCTTTTAF59.3250Ad ≠ (As = BatSten = GregSten = Ah = Am)
DS_c1614_886_A02_88903581_Fwd_FAMGAAGGTGACCAAGTTCATGCTCAGATACAGTGACAGATATGAATGGTGAS61.0240.74G
DS_c1614_886_A02_88903581_Fwd_VICGAAGGTCGGAGTCAACGGATTTCAGATACAGTGACAGATATGAATGGTAAS60.235.71A
TOG894171_695_A02_92486807_Rev_CTTCTGTTGGGGTGTTGGATAF59.8250(As = BatSten = GregSten) ≠ (Ad = Ah = Am)*
TOG894171_695_A02_92486807_Fwd_VICGAAGGTCGGAGTCAACGGATTYATTAATCAGGCAATAGCAACGAS59.6536.36G
TOG894171_695_A02_92486807_Fwd_FAMGAAGGTGACCAAGTTCATGCTCTAYATTAATCAGGCAATAGCAACAAS59.6232A
Nem_Aradu.A02_92631394_Fwd_AAGAAATTGGGCGTTTTCAGAF68118(As = Ah = Am) ≠ Ad ≠ (BatSten = GregSten)*
Nem_Aradu.A02_92631394_Rev_FAMGAAGGTGACCAAGTTCATGCTATCCCCATATCTAGTGTCTTCTGCAS59.8945.83A
Nem_Aradu.A02_92631394_Rev_VICGAAGGTCGGAGTCAACGGATTCAATCCCCATATCTAGTGTCTTCTGTAS60.9442.31G
Nem_Aradu.A04_109789467_Rev_CCAAAGCTCTTTTCCAGGTTAF58.4445(As) ≠ (BatSten = GregSten) ≠ (Ad = Ah = Am)*
Nem_Aradu.A04_109789467_Fwd_FAMGAAGGTGACCAAGTTCATGCTCAATAGAAACAGCAAAGCAATGGAS60.9839.13A
Nem_Aradu.A04_109789467_Fwd_VICGAAGGTCGGAGTCAACGGATTCAATAGAAACAGCAAAGCAATGAAS59.4434.78G
TOG906490_74_A04_106874754_Fwd_TTCATTCCATAAGCCCAACCAF59.7645(As = BatSten = GregSten) ≠ (Ad = Ah = Am)*
TOG906490_74_A04_106874754_Rev_VICGAAGGTCGGAGTCAACGGATTAACTTTTCGAATCCTCATATTGCTAS59.5733.33A
TOG906490_74_A04_106874754_Rev_FAMGAAGGTGACCAAGTTCATGCTTTTTCGAATCCTCATATTGCGAS60.0538.1C
TOG937303_589_A04_108564975_Rev_CCATCACAAAAGAACAAAACAACAF58.5734.78ND
TOG937303_589_A04_108564975_Fwd_FAMGAAGGTGACCAAGTTCATGCTAATTACTCGTTGGAGTAGTTGATGGAS59.8540G
TOG937303_589_A04_108564975_Fwd_VICGAAGGTCGGAGTCAACGGATTGAATTACTCGTTGGAGTAGTTGATGAAS59.9638.46A
Nem_Aradu.A04_113373632_Rev_TCCTCATCATCATCTTTCTCCAAF59.6340.91ND
Nem_Aradu.A04_113373632_Fwd_FAMGAAGGTGACCAAGTTCATGCTAGGTTGGTCAAGGGTTTCAGAS59.0450A
Nem_Aradu.A04_113373632_Fwd_VICGAAGGTCGGAGTCAACGGATTAGGTTGGTCAAGGGTTTCAAAS59.4245G
TOG896942_133_A09_114770700_Fwd_AAAGAAAGGGCTCCCTAATTTCAF59.1640.91(As = BatSten = GregSten) ≠ (Ad = Ah = Am)*
TOG896942_133_A09_114770700_Rev_FAMGAAGGTGACCAAGTTCATGCTGGGCACAAAAATTCGCTACAAS6145T
TOG896942_133_A09_114770700_Rev_VICGAAGGTCGGAGTCAACGGATTGGCACAAAAATTCGCTACGAS59.3247.37C
Nem_Aradu.A04_114769893_Fwd_TCAAGTCGTGTGTTCTCTACACCAF59.3247.83(As = BatSten = GregSten = Ad = Ah = Am)
Nem_Aradu.A04_114769893_Rev_FAMGAAGGTGACCAAGTTCATGCTTCTTGTGACATGAGCTACAACTTCTAS59.5340C
Nem_Aradu.A04_114769893_Rev_VICGAAGGTCGGAGTCAACGGATTTTGTGACATGAGCTACAACTTCGAS60.3543.48A
Nem_Aradu.A04_115457181_Rev_TGTGGACAGATGGAAAACACAAF59.9942.86(As = GregSten) ≠ (BatSten = Ad = Ah = Am)*
Nem_Aradu.A04_115457181_Fwd_VICGAAGGTCGGAGTCAACGGATTTTCGGCGTTGGACTGTGAS60.458.82G
Nem_Aradu.A04_115457181_Fwd_FAMGAAGGTGACCAAGTTCATGCTCTTCGGCGTTGGACTGTAAS58.3555.56A
Nem_Aradu.A04_117955004_Fwd_TCACGGTCCATGTATTCAGCAF59.5350(As = GregSten = BatSten = Am) ≠ (Ad = Ah)*
Nem_Aradu.A04_117955004_Rev_VICGAAGGTCGGAGTCAACGGATTCGTTAGCAGTTGGACAAACAAACAS59.7650G
Nem_Aradu.A04_117955004_Rev_FAMGAAGGTGACCAAGTTCATGCTCGTTAGCAGTTGGACAAACAAATAS60.9543.48A
Nem_Aradu.A04_121132127_Rev_AGATTTTCTGGGCCCATTTTAF59.7840(As = BatSten = GregSten) ≠ (Ad = Ah = Am)*
Nem_Aradu.A04_121132127_Fwd_VICGAAGGTCGGAGTCAACGGATTGCCAAGCAAAGTAATGCCGAS61.6752.63G
Nem_Aradu.A04_121132127_Fwd_FAMGAAGGTGACCAAGTTCATGCTGCCAAGCAAAGTAATGCCAAS59.8247.37A
Nem_Aradu.A04_121183243_Rev_AAGGTTGGGAATGTCAAGGAAF59.3845(As = BatSten = GregSten = Ad = Ah = Am)
Nem_Aradu.A04_121183243_Fwd_FAMGAAGGTGACCAAGTTCATGCTAACTGGTAGGTTTGGAAATAATCGAS59.737.5C
Nem_Aradu.A04_121183243_Fwd_VICGAAGGTCGGAGTCAACGGATTAAACTGGTAGGTTTGGAAATAATCCAS59.9136G
Nem_Aradu.A09_112396428_Fwd_TATGATTGGCCCCCTAAATGAF59.6245(As = BatSten = GregSten) ≠ Ad ≠ (Ah = Am)*
Nem_Aradu.A09_112396428_Rev_FAMGAAGGTGACCAAGTTCATGCTAGCCCCCTCTTCTAAAACAACAS58.7747.62A
Nem_Aradu.A09_112396428_Rev_VICGAAGGTCGGAGTCAACGGATTCAGCCCCCTCTTCTAAAACAATAS60.8145.45G
Nem_Aradu.A09_112396635_Rev_CCTGGCTTCATGTTTGATGAAF59.6545Ad ≠ (As = BatSten = GregSten = Ah = Am)
Nem_Aradu.A09_112396635_Fwd_VICGAAGGTCGGAGTCAACGGATTAATGTTACAAAAGGATCCCCAGAS59.2440.91G
Nem_Aradu.A09_112396635_Fwd_FAMGAAGGTGACCAAGTTCATGCTAATGTTACAAAAGGATCCCCAAAS59.5936.36A
Nem_Aradu.A09_112399976_Rev_TGACGAGAAGGGGAAAGAAAAF59.7845(As = BatSten = GregSten = Ad = Ah = Am)
Nem_Aradu.A09_112399976_Fwd_FAMGAAGGTGACCAAGTTCATGCTAATCCTATTACTAAATCGCTGCTTTTAS59.2730.77C
Nem_Aradu.A09_112399976_Fwd_VICGAAGGTCGGAGTCAACGGATTAATCCTATTACTAAATCGCTGCTTTCAS59.6534.62G
Nem_Aradu.A09_112901114_Rev_CTCCCCAATTTCTCAGCAAGAF59.8150(As) ≠ (BatSten = GregSten) ≠ (Ad = Ah = Am)*
Nem_Aradu.A09_112901114_Fwd_FAMGAAGGTGACCAAGTTCATGCTAGGTGTTGACAGAATTACAACCGAS60.3243.48A
Nem_Aradu.A09_112901114_Fwd_VICGAAGGTCGGAGTCAACGGATTGAGGTGTTGACAGAATTACAACCAAS60.3241.67G
Nem_Aradu.A09_114001128_Rev_TTAAAGCCCCTGCTTTTTCAAF59.8340(As = BatSten = GregSten) ≠ (Ad = Ah = Am)*
Nem_Aradu.A09_114001128_Fwd_FAMGAAGGTGACCAAGTTCATGCTATGAGGGAACAACCAGCACTAAS59.6147.62C
Nem_Aradu.A09_114001128_Fwd_VICGAAGGTCGGAGTCAACGGATTTGAGGGAACAACCAGCACTCAS61.2655A
DS_c14276_456_A09_115161052_Rev_AGGAGTCATGGGATGGAATGAF59.7450(As = Ad = GregSten) ≠ (BatSten = Ah = Am)*
DS_c14276_456_A09_115161052_Fwd_VICGAAGGTCGGAGTCAACGGATTTTTGGAAACATCAGCAAAGGAAS60.638.1A
DS_c14276_456_A09_115161052_Fwd_FAMGAAGGTGACCAAGTTCATGCTTGGAAACATCAGCAAAGGCAS59.7947.37C
TOG896078_413_A09_116503861_Rev_GTGGAAGAAATAGCAAAATGGAAF58.2536.36(As = BatSten = GregSten) ≠ (Ad = Ah = Am)*
TOG896078_413_A09_116503861_Fwd_VICGAAGGTCGGAGTCAACGGATTAAGGAGTTATGGAGATGGTAAGTTTTAS59.0234.62T
TOG896078_413_A09_116503861_Fwd_FAMGAAGGTGACCAAGTTCATGCTAAGGAGTTATGGAGATGGTAAGTTTCAS59.4138.46C
TOG903757_1119_A09_116533871_Rev_CCCAAGAAGCAGGGTACTTTAF58.3250(As = BatSten = GregSten = Ad = Ah = Am)
TOG903757_1119_A09_116533871_Fwd_VICGAAGGTCGGAGTCAACGGATTACTTGATTTGATATGAGATTTCCTGAS57.8332G
TOG903757_1119_A09_116533871_Fwd_FAMGAAGGTGACCAAGTTCATGCTCACTTGATTTGATATGAGATTTCCTCAS59.4534.62C
  • LG, Linkage group; TM, melting temperature; GC%, GC content; AF, Allele Flanking; As, Arachis stenosperma; BatSten, (Arachis batizocoi × A. stenosperma)4x, GregSten = (Arachis gregoryi × A. stenosperma)4x; Ad, Arachis duranensis; Ah, Arachis hypogaea; Am, Arachis monticola; AS, Allele specific; ND, Not defined/assay did not work.

  • a Dye: Reference (A. duranensis) alleles are coupled with VIC and alternative (A. stenosperma) alleles are coupled with FAM.

  • b Asterisk indicate assays that distinguish A. stenosperma-derived allotetraploids from A. hypogaea.